Transcript: Mouse NM_025550.2

Mus musculus proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 (Psmd6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Psmd6 (66413)
Length:
1313
CDS:
22..1191

Additional Resources:

NCBI RefSeq record:
NM_025550.2
NBCI Gene record:
Psmd6 (66413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249966 TCTCTATGAATGCCGTTATTC pLKO_005 807 CDS 100% 13.200 18.480 N Psmd6 n/a
2 TRCN0000249968 CGCCTCATTACCGATACTATG pLKO_005 887 CDS 100% 10.800 15.120 N Psmd6 n/a
3 TRCN0000249967 TCGACACTGTTTCTACGTTTA pLKO_005 626 CDS 100% 10.800 15.120 N Psmd6 n/a
4 TRCN0000249965 TTTCGCAAGACATACGATAAG pLKO_005 391 CDS 100% 10.800 15.120 N Psmd6 n/a
5 TRCN0000202483 GCGCCTCATTACCGATACTAT pLKO.1 886 CDS 100% 5.625 7.875 N Psmd6 n/a
6 TRCN0000189691 GCAGAGTACCTCTGTCAGATA pLKO.1 343 CDS 100% 4.950 6.930 N Psmd6 n/a
7 TRCN0000217349 GTCATTAACCCTCGGCTATAT pLKO.1 957 CDS 100% 13.200 9.240 N Psmd6 n/a
8 TRCN0000249964 GTCATTAACCCTCGGCTATAT pLKO_005 957 CDS 100% 13.200 9.240 N Psmd6 n/a
9 TRCN0000142957 CTTGAAGTGTTGCACAGTCTT pLKO.1 760 CDS 100% 4.950 3.465 N PSMD6 n/a
10 TRCN0000343967 CTTGAAGTGTTGCACAGTCTT pLKO_005 760 CDS 100% 4.950 3.465 N PSMD6 n/a
11 TRCN0000145517 GCTGGAATCATATAGGTCATT pLKO.1 942 CDS 100% 4.950 3.465 N PSMD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02262 pDONR223 100% 89.2% 97.9% None (many diffs) n/a
2 ccsbBroad304_02262 pLX_304 0% 89.2% 97.9% V5 (many diffs) n/a
3 TRCN0000470350 CGGTCAGACGATATGCCCAGTATT pLX_317 41.1% 89.2% 97.9% V5 (many diffs) n/a
Download CSV