Construct: ORF TRCN0000470350
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012264.1_s317c1
- Derived from:
- ccsbBroadEn_02262
- DNA Barcode:
- CGGTCAGACGATATGCCCAGTATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PSMD6 (9861)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470350
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9861 | PSMD6 | proteasome 26S subunit, non... | NM_014814.2 | 100% | 100% | |
| 2 | human | 9861 | PSMD6 | proteasome 26S subunit, non... | NM_001271781.1 | 89.9% | 89.7% | 28_29ins117 |
| 3 | human | 9861 | PSMD6 | proteasome 26S subunit, non... | NM_001271780.1 | 89.2% | 86.3% | (many diffs) |
| 4 | human | 9861 | PSMD6 | proteasome 26S subunit, non... | XM_017007569.1 | 88.2% | 87.4% | (many diffs) |
| 5 | human | 9861 | PSMD6 | proteasome 26S subunit, non... | NM_001271779.1 | 88% | 88% | 146_304del |
| 6 | human | 9861 | PSMD6 | proteasome 26S subunit, non... | XM_005265619.1 | 87.4% | 87.4% | 0_1ins147 |
| 7 | human | 9861 | PSMD6 | proteasome 26S subunit, non... | XM_011534288.1 | 65.6% | 61.4% | 146_304del;985_986ins169;1029_1030ins128 |
| 8 | human | 9861 | PSMD6 | proteasome 26S subunit, non... | XM_024453841.1 | 63.8% | 56.7% | (many diffs) |
| 9 | mouse | 66413 | Psmd6 | proteasome (prosome, macrop... | NM_025550.2 | 89.2% | 97.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 65
- ORF end:
- 1232
- ORF length:
- 1167
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggatgccg ctggagaacc tggaggagga gggtctgccc aagaaccccg acttgcgtat 121 cgcgcagctg cgcttcctgc tcagcctgcc cgagcaccgc ggagacgctg ccgtgcgcga 181 cgagctgatg gcggccgtcc gcgataacaa catggctcct tactatgaag ccttgtgcaa 241 atccctcgac tggcagatag acgtggacct actcaataaa atgaagaagg caaatgaaga 301 tgagttgaag cgtttggatg aggagctgga agatgcagag aagaatctag gagagagcga 361 aattcgcgat gcaatgatgg caaaggccga gtacctctgc cggataggtg acaaagaggg 421 agctctgaca gcctttcgca agacatatga caaaactgtg gccctgggtc accgattgga 481 tattgtattc tatctcctta ggattggctt attttatatg gataatgatc tcatcacacg 541 aaacacagaa aaggccaaaa gcttaataga agaaggagga gactgggaca ggagaaaccg 601 cctaaaagtg tatcagggtc tttattgtgt ggctattcgt gatttcaaac aggcagctga 661 actcttcctt gacactgttt caacatttac atcctatgaa ctcatggatt ataaaacatt 721 tgtgacttat actgtctatg tcagtatgat tgccTTAGAA AGACCAGATC TCAGGGAAAA 781 GGTCATTAAA GGAGCAGAGA TTCTTGAAGT GTTGCACAGT CTTCCAGCAG TTCGGCAGTA 841 TCTGTTTTCA CTCTATGAAT GCCGTTACTC TGTTTTCTTC CAATCATTAG CGGTTGTGGA 901 ACAGGAAATG AAAAAGGACT GGCTTTTTGC CCCTCATTAT CGATACTATG TAAGAGAAAT 961 GAGAATTCAT GCATACAGTC AGCTGCTGGA ATCATATAGG TCATTAACCC TTGGCTATAT 1021 GGCAGAAGCG TTTGGTGTTG GTGTGGAATT CATTGATCAG GAACTGTCCA GGTTTATTGC 1081 TGCCGGGAGA CTACACTGCA AAATAGATAA AGTGAATGAA ATAGTAGAAA CCAACAGACC 1141 TGATAGCAAG AACTGGCAGT ACCAAGAAAC TATCAAGAAA GGAGATCTGC TACTAAACAG 1201 AGTTCAAAAA CTTTCCAGAG TAATTAATAT GTACCCAACT TTCTTGTACA AAGTGGTTGA 1261 TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG 1321 TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACGG 1381 TCAGACGATA TGCCCAGTAT TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt 1441 tgtgaaagat t