Transcript: Mouse NM_025553.4

Mus musculus mitochondrial ribosomal protein L11 (Mrpl11), mRNA.

Source:
NCBI, updated 2017-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mrpl11 (66419)
Length:
2882
CDS:
88..666

Additional Resources:

NCBI RefSeq record:
NM_025553.4
NBCI Gene record:
Mrpl11 (66419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025553.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104352 CTGCAAAGAGTTCAACGAGAA pLKO.1 234 CDS 100% 4.050 5.670 N Mrpl11 n/a
2 TRCN0000349445 CTGCAAAGAGTTCAACGAGAA pLKO_005 234 CDS 100% 4.050 5.670 N Mrpl11 n/a
3 TRCN0000104350 CTTTCTACACTCTGAGAATTT pLKO.1 673 3UTR 100% 13.200 9.240 N Mrpl11 n/a
4 TRCN0000312376 CTTTCTACACTCTGAGAATTT pLKO_005 673 3UTR 100% 13.200 9.240 N Mrpl11 n/a
5 TRCN0000104351 CAGCCCACTGTTTCTTACTTT pLKO.1 337 CDS 100% 5.625 3.938 N Mrpl11 n/a
6 TRCN0000312315 CAGCCCACTGTTTCTTACTTT pLKO_005 337 CDS 100% 5.625 3.938 N Mrpl11 n/a
7 TRCN0000104353 AGGTGTCTCTATCAACCAGTT pLKO.1 213 CDS 100% 4.050 2.835 N Mrpl11 n/a
8 TRCN0000312375 AGGTGTCTCTATCAACCAGTT pLKO_005 213 CDS 100% 4.050 2.835 N Mrpl11 n/a
9 TRCN0000104354 CTGGTGAGTTTGAAGCACGTA pLKO.1 418 CDS 100% 2.640 1.848 N Mrpl11 n/a
10 TRCN0000349388 CTGGTGAGTTTGAAGCACGTA pLKO_005 418 CDS 100% 2.640 1.848 N Mrpl11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025553.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08885 pDONR223 100% 85.2% 87.5% None (many diffs) n/a
2 ccsbBroad304_08885 pLX_304 0% 85.2% 87.5% V5 (many diffs) n/a
3 TRCN0000478717 ACTGAGACACCTTGAGGCGTACAT pLX_317 54.1% 85.2% 87.5% V5 (many diffs) n/a
Download CSV