Transcript: Mouse NM_025578.4

Mus musculus mitochondrial ribosomal protein S25 (Mrps25), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mrps25 (64658)
Length:
6076
CDS:
51..566

Additional Resources:

NCBI RefSeq record:
NM_025578.4
NBCI Gene record:
Mrps25 (64658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104421 CGTGGAGACGAAGAGTAATAA pLKO.1 317 CDS 100% 15.000 21.000 N Mrps25 n/a
2 TRCN0000104423 ACCGTGAACTACAACACGTAT pLKO.1 141 CDS 100% 4.950 6.930 N Mrps25 n/a
3 TRCN0000104420 CCCTGATTGATGCCATGACTA pLKO.1 5046 3UTR 100% 4.950 6.930 N Mrps25 n/a
4 TRCN0000117703 GCAGATCATGATGTTTAAGAA pLKO.1 236 CDS 100% 5.625 3.938 N MRPS25 n/a
5 TRCN0000104424 CTGCTCTGAAAGCCAGTACTT pLKO.1 544 CDS 100% 4.950 3.465 N Mrps25 n/a
6 TRCN0000104422 CCCTCAGATCCAGTATAAGAA pLKO.1 206 CDS 100% 5.625 3.375 N Mrps25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03953 pDONR223 100% 85% 88.4% None (many diffs) n/a
2 ccsbBroad304_03953 pLX_304 0% 85% 88.4% V5 (many diffs) n/a
3 TRCN0000465548 GGTCATCTCACATTTCGTTTGACG pLX_317 69% 85% 88.4% V5 (many diffs) n/a
Download CSV