Transcript: Mouse NM_025592.3

Mus musculus ribosomal protein L35 (Rpl35), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rpl35 (66489)
Length:
452
CDS:
46..417

Additional Resources:

NCBI RefSeq record:
NM_025592.3
NBCI Gene record:
Rpl35 (66489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025592.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104419 CTGTTATTAACCAGACTCAAA pLKO.1 221 CDS 100% 4.950 6.930 N Rpl35 n/a
2 TRCN0000104416 CTGTTGAAACAACTGGACGAT pLKO.1 94 CDS 100% 2.640 2.112 N Rpl35 n/a
3 TRCN0000104415 CCGAGTCCTCACTGTTATTAA pLKO.1 210 CDS 100% 15.000 10.500 N Rpl35 n/a
4 TRCN0000430451 GAAATTCTACAAGGGCAAGAA pLKO_005 255 CDS 100% 4.950 3.465 N RPL35 n/a
5 TRCN0000104418 CTCTCCAAGATACGAGTCGTT pLKO.1 175 CDS 100% 2.640 1.848 N Rpl35 n/a
6 TRCN0000104417 CAGGAAATTCTACAAGGGCAA pLKO.1 252 CDS 100% 2.160 1.512 N Rpl35 n/a
7 TRCN0000187744 GCTGTTGAAACAACTGGACAA pLKO.1 93 CDS 100% 4.050 2.835 N Rpl35-ps1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025592.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02650 pDONR223 100% 89.1% 98.3% None (many diffs) n/a
2 ccsbBroad304_02650 pLX_304 0% 89.1% 98.3% V5 (many diffs) n/a
3 TRCN0000481144 GCCGCTCGGGGCGGGCTCAGAAGT pLX_317 100% 89.1% 98.3% V5 (many diffs) n/a
4 ccsbBroadEn_07775 pDONR223 100% 88.8% 97.5% None (many diffs) n/a
5 ccsbBroad304_07775 pLX_304 0% 88.8% 97.5% V5 (many diffs) n/a
6 TRCN0000471572 CAGGTTTGCGTCCCTCCTCAGACA pLX_317 98.4% 88.8% 97.5% V5 (many diffs) n/a
Download CSV