Transcript: Mouse NM_025628.2

Mus musculus cytochrome c oxidase, subunit VIb polypeptide 1 (Cox6b1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cox6b1 (110323)
Length:
505
CDS:
110..370

Additional Resources:

NCBI RefSeq record:
NM_025628.2
NBCI Gene record:
Cox6b1 (110323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076500 AGAACCAGACTAAGAACTGTT pLKO.1 180 CDS 100% 4.950 6.930 N Cox6b1 n/a
2 TRCN0000076502 TCCACCGCTGTGAGAAGGCAA pLKO.1 219 CDS 100% 0.880 1.232 N Cox6b1 n/a
3 TRCN0000076501 GCCTGGGATGACCGCATAGCT pLKO.1 323 CDS 100% 0.000 0.000 N Cox6b1 n/a
4 TRCN0000076498 CGCATAGCTGAAGGCACATTT pLKO.1 335 CDS 100% 13.200 9.240 N Cox6b1 n/a
5 TRCN0000076499 CCAGACTAAGAACTGTTGGCA pLKO.1 184 CDS 100% 0.750 0.525 N Cox6b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00353 pDONR223 100% 85.8% 84.8% None (many diffs) n/a
2 ccsbBroad304_00353 pLX_304 0% 85.8% 84.8% V5 (many diffs) n/a
Download CSV