Transcript: Mouse NM_025664.5

Mus musculus sorting nexin 9 (Snx9), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Snx9 (66616)
Length:
2078
CDS:
156..1943

Additional Resources:

NCBI RefSeq record:
NM_025664.5
NBCI Gene record:
Snx9 (66616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025664.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147006 CAAGCTGAGATGAATCACTTT pLKO.1 1800 CDS 100% 4.950 6.930 N SNX9 n/a
2 TRCN0000093359 CGTTGGAGATTATGGCCCTAT pLKO.1 860 CDS 100% 4.050 5.670 N Snx9 n/a
3 TRCN0000093360 CGATCTGTAAACCACAGATAT pLKO.1 996 CDS 100% 1.320 1.848 N Snx9 n/a
4 TRCN0000309606 CGATCTGTAAACCACAGATAT pLKO_005 996 CDS 100% 1.320 1.848 N Snx9 n/a
5 TRCN0000093361 CCTACTGACTACGTGGAAATT pLKO.1 312 CDS 100% 13.200 9.240 N Snx9 n/a
6 TRCN0000309607 CCTACTGACTACGTGGAAATT pLKO_005 312 CDS 100% 13.200 9.240 N Snx9 n/a
7 TRCN0000379913 CTCTGCAAGCTGAGATGAATC pLKO_005 1795 CDS 100% 10.800 7.560 N Snx9 n/a
8 TRCN0000380832 TTCACAGTAACCGGATCTATG pLKO_005 1819 CDS 100% 10.800 7.560 N Snx9 n/a
9 TRCN0000093362 CACAGATATAAGCACTTTGAT pLKO.1 1008 CDS 100% 5.625 3.938 N Snx9 n/a
10 TRCN0000309666 CACAGATATAAGCACTTTGAT pLKO_005 1008 CDS 100% 5.625 3.938 N Snx9 n/a
11 TRCN0000093363 CCTGACTTGGATTTGATAGAA pLKO.1 1317 CDS 100% 5.625 3.938 N Snx9 n/a
12 TRCN0000309665 CCTGACTTGGATTTGATAGAA pLKO_005 1317 CDS 100% 5.625 3.938 N Snx9 n/a
13 TRCN0000146586 CCCTTAACAAATTTCCTGGAT pLKO.1 766 CDS 100% 2.640 1.848 N SNX9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025664.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08290 pDONR223 100% 87.1% 90.4% None (many diffs) n/a
2 ccsbBroad304_08290 pLX_304 0% 87.1% 90.4% V5 (many diffs) n/a
3 TRCN0000467316 TTTGCGCCCGGTCTCGGCCTCAGT pLX_317 16.3% 87.1% 90.4% V5 (many diffs) n/a
Download CSV