Transcript: Mouse NM_025701.4

Mus musculus trafficking protein particle complex 5 (Trappc5), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Trappc5 (66682)
Length:
2072
CDS:
137..703

Additional Resources:

NCBI RefSeq record:
NM_025701.4
NBCI Gene record:
Trappc5 (66682)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025701.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248051 GGACCACACTCATGATCAAAT pLKO_005 636 CDS 100% 13.200 18.480 N Trappc5 n/a
2 TRCN0000248050 CCCGCACTTTCTACATCATCG pLKO_005 471 CDS 100% 4.050 5.670 N Trappc5 n/a
3 TRCN0000248053 CCACATAAAGTGGGTACAAAT pLKO_005 1068 3UTR 100% 13.200 9.240 N Trappc5 n/a
4 TRCN0000201674 GCCGTGGGTTTGATTCCTTAT pLKO.1 1046 3UTR 100% 10.800 7.560 N Trappc5 n/a
5 TRCN0000190790 GCCGCTCATTAACACCTACAT pLKO.1 499 CDS 100% 4.950 3.465 N Trappc5 n/a
6 TRCN0000248052 GCCGCTCATTAACACCTACAT pLKO_005 499 CDS 100% 4.950 3.465 N Trappc5 n/a
7 TRCN0000248054 TTTCTCTGTGGCCGAGCTTCA pLKO_005 268 CDS 100% 4.050 2.835 N Trappc5 n/a
8 TRCN0000190892 CAAGGAGAACAGCACACTGAA pLKO.1 529 CDS 100% 4.950 2.970 N Trappc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025701.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04805 pDONR223 100% 89.1% 98.9% None (many diffs) n/a
2 ccsbBroad304_04805 pLX_304 0% 89.1% 98.9% V5 (many diffs) n/a
3 TRCN0000471895 AAGGTAACACGGACACAATTTAGA pLX_317 81.5% 89.1% 98.9% V5 (many diffs) n/a
Download CSV