Transcript: Mouse NM_025706.3

Mus musculus TBC1 domain family, member 15 (Tbc1d15), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d15 (66687)
Length:
3779
CDS:
83..2098

Additional Resources:

NCBI RefSeq record:
NM_025706.3
NBCI Gene record:
Tbc1d15 (66687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250024 TCTAGATATACTTCGATTATG pLKO_005 1657 CDS 100% 13.200 18.480 N Tbc1d15 n/a
2 TRCN0000250023 TTAACACCTGCATGATCATTT pLKO_005 2084 CDS 100% 13.200 18.480 N Tbc1d15 n/a
3 TRCN0000216709 CTTCGATTATGGGAGGTAATG pLKO.1 1667 CDS 100% 10.800 15.120 N Tbc1d15 n/a
4 TRCN0000178016 GCACATCAATGAGTTGTCCAT pLKO.1 1798 CDS 100% 2.640 2.112 N Tbc1d15 n/a
5 TRCN0000250025 CCTGTCTATACCTGGTATAAA pLKO_005 2888 3UTR 100% 15.000 10.500 N Tbc1d15 n/a
6 TRCN0000250022 AGGGCATGAAGACGCAGTTAA pLKO_005 1509 CDS 100% 13.200 9.240 N Tbc1d15 n/a
7 TRCN0000217350 GATGAACTGGGATTGGATAAA pLKO.1 2348 3UTR 100% 13.200 9.240 N Tbc1d15 n/a
8 TRCN0000250021 TGATTCTGCTTCACGACATTT pLKO_005 1329 CDS 100% 13.200 9.240 N Tbc1d15 n/a
9 TRCN0000176593 CTTCTAGTCAATTGTCAGAAT pLKO.1 659 CDS 100% 4.950 3.465 N Tbc1d15 n/a
10 TRCN0000181470 CGGAAAGGCAAATGACCAAGA pLKO.1 154 CDS 100% 4.050 2.835 N Tbc1d15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12494 pDONR223 100% 85.1% 88.8% None (many diffs) n/a
2 ccsbBroad304_12494 pLX_304 0% 85.1% 88.8% V5 (many diffs) n/a
Download CSV