Transcript: Mouse NM_025719.3

Mus musculus NFKB activating protein-like (Nkapl), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Nkapl (66707)
Length:
1455
CDS:
61..1248

Additional Resources:

NCBI RefSeq record:
NM_025719.3
NBCI Gene record:
Nkapl (66707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025719.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191104 GCAGAGAGCATGGATTTAATA pLKO.1 853 CDS 100% 15.000 10.500 N Nkapl n/a
2 TRCN0000191024 CTCAAGAAGAAGAGGACTAAA pLKO.1 754 CDS 100% 13.200 9.240 N Nkapl n/a
3 TRCN0000200815 GAAGAGTAGCAGTTCAGATTT pLKO.1 546 CDS 100% 13.200 9.240 N Nkapl n/a
4 TRCN0000135451 GAGGTGAAATTGGGTTGACAA pLKO.1 1001 CDS 100% 4.950 2.970 N NKAPL n/a
5 TRCN0000202079 CCTGTTTGTTTCACTGTGGGA pLKO.1 1252 3UTR 100% 0.660 0.330 Y Nkapl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025719.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.