Transcript: Mouse NM_025802.3

Mus musculus patatin-like phospholipase domain containing 2 (Pnpla2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pnpla2 (66853)
Length:
2467
CDS:
100..1392

Additional Resources:

NCBI RefSeq record:
NM_025802.3
NBCI Gene record:
Pnpla2 (66853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184511 GCACATTTATCCCGGTGTACT pLKO.1 533 CDS 100% 4.950 6.930 N Pnpla2 n/a
2 TRCN0000249777 ACGGAGAGAACGTCATCATAT pLKO_005 467 CDS 100% 13.200 10.560 N Pnpla2 n/a
3 TRCN0000249778 GTGAAGCAGGTGCCAACATTA pLKO_005 287 CDS 100% 13.200 9.240 N Pnpla2 n/a
4 TRCN0000249774 CATCTCCCTGACTCGTGTTTC pLKO_005 444 CDS 100% 10.800 7.560 N Pnpla2 n/a
5 TRCN0000249776 CTATGTGGATGGCGGCATTTC pLKO_005 588 CDS 100% 10.800 7.560 N Pnpla2 n/a
6 TRCN0000249775 TGCTGTGGAATGAGGACATAG pLKO_005 1507 3UTR 100% 10.800 7.560 N Pnpla2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08697 pDONR223 100% 73.2% 77.3% None (many diffs) n/a
2 ccsbBroad304_08697 pLX_304 0% 73.2% 77.3% V5 (many diffs) n/a
3 TRCN0000468882 TCTGTAAGCTCTGTTATACATTCA pLX_317 29.5% 73.2% 77.3% V5 (many diffs) n/a
Download CSV