Transcript: Mouse NM_025813.3

Mus musculus major facilitator superfamily domain containing 1 (Mfsd1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mfsd1 (66868)
Length:
2978
CDS:
51..1445

Additional Resources:

NCBI RefSeq record:
NM_025813.3
NBCI Gene record:
Mfsd1 (66868)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025813.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338002 TTGCATCGGACAGGTTATATT pLKO_005 407 CDS 100% 15.000 21.000 N Mfsd1 n/a
2 TRCN0000193274 CACTTATGATTGGGTGTATAA pLKO.1 688 CDS 100% 13.200 10.560 N Mfsd1 n/a
3 TRCN0000337937 CACTTATGATTGGGTGTATAA pLKO_005 688 CDS 100% 13.200 10.560 N Mfsd1 n/a
4 TRCN0000059690 CCTTAGCAGTTGCCCAGAATA pLKO.1 502 CDS 100% 13.200 9.240 N MFSD1 n/a
5 TRCN0000175879 GACACTTATGATTGGGTGTAT pLKO.1 686 CDS 100% 4.950 3.465 N Mfsd1 n/a
6 TRCN0000176093 GTCTCCATTATTTGGACTCTT pLKO.1 995 CDS 100% 4.950 3.465 N Mfsd1 n/a
7 TRCN0000337938 GTCTCCATTATTTGGACTCTT pLKO_005 995 CDS 100% 4.950 3.465 N Mfsd1 n/a
8 TRCN0000174483 CCAGAAATCAAATCTGCAATA pLKO.1 2106 3UTR 100% 10.800 6.480 N Mfsd1 n/a
9 TRCN0000337939 CCAGAAATCAAATCTGCAATA pLKO_005 2106 3UTR 100% 10.800 6.480 N Mfsd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025813.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14246 pDONR223 100% 85% 87.9% None (many diffs) n/a
2 ccsbBroad304_14246 pLX_304 0% 85% 87.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472389 CAAACTAGACCTTGCACTCTCTGA pLX_317 30.9% 85% 87.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV