Transcript: Mouse NM_025835.3

Mus musculus propionyl Coenzyme A carboxylase, beta polypeptide (Pccb), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pccb (66904)
Length:
2306
CDS:
28..1653

Additional Resources:

NCBI RefSeq record:
NM_025835.3
NBCI Gene record:
Pccb (66904)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025835.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112470 GCTATGTGATGTCTCGATATT pLKO.1 2103 3UTR 100% 13.200 18.480 N Pccb n/a
2 TRCN0000112474 CCCGCAGATTTCTCTGATCAT pLKO.1 603 CDS 100% 4.950 6.930 N Pccb n/a
3 TRCN0000112473 GAATCAATGGACGATTGGTTT pLKO.1 371 CDS 100% 4.950 6.930 N Pccb n/a
4 TRCN0000112471 GCTGCTGATAAGAATAAGTTT pLKO.1 319 CDS 100% 5.625 3.938 N Pccb n/a
5 TRCN0000112472 CCTGAAGTTGTGAAGTCTGTT pLKO.1 715 CDS 100% 4.950 3.465 N Pccb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025835.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01150 pDONR223 100% 87.3% 92.4% None (many diffs) n/a
2 ccsbBroad304_01150 pLX_304 0% 87.3% 92.4% V5 (many diffs) n/a
3 TRCN0000466268 GGCCCTATAACGGGCCCAATGTCC pLX_317 13.2% 87.3% 92.4% V5 (many diffs) n/a
Download CSV