Construct: ORF TRCN0000466268
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017579.1_s317c1
- Derived from:
- ccsbBroadEn_01150
- DNA Barcode:
- GGCCCTATAACGGGCCCAATGTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PCCB (5096)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466268
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5096 | PCCB | propionyl-CoA carboxylase s... | NM_000532.5 | 100% | 100% | |
| 2 | human | 5096 | PCCB | propionyl-CoA carboxylase s... | NM_001178014.1 | 96.4% | 96.4% | 371_430del |
| 3 | human | 5096 | PCCB | propionyl-CoA carboxylase s... | XM_011512873.2 | 70.4% | 68% | (many diffs) |
| 4 | mouse | 66904 | Pccb | propionyl Coenzyme A carbox... | NM_025835.3 | 87.3% | 92.4% | (many diffs) |
| 5 | mouse | 66904 | Pccb | propionyl Coenzyme A carbox... | NM_001311149.1 | 81% | 85.5% | (many diffs) |
| 6 | mouse | 66904 | Pccb | propionyl Coenzyme A carbox... | XM_006511370.2 | 80.6% | 85.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1683
- ORF length:
- 1617
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcggcatta cgggtggcgg cggtcggggc aaggctcagc gttctggcga 121 gcggtctccg cgccgcggtc cgcagccttt gcagccaggc cacctctgtt aacgaacgca 181 tcgaaaacaa gcgccggacc gcgctgctgg gagggggcca acgccgtatt gacgcgcagc 241 acaagcgagg aaagctaaca gccagggaga ggatcagtct cttgctggac cctggcagct 301 ttgttgagag cgacatgttt gtggaacaca gatgtgcaga ttttggaatg gctgctgata 361 agaataagtt tcctggagac agcgtggtca ctggacgagg ccgaatcaat ggaagattgg 421 tttatgtctt cagtcaggat tttacagttt ttggaggcag tctgtcagga gcacatgccc 481 aaaagatctg caaaatcatg gaccaggcca taacggtggg ggctccagtg attgggctga 541 atgactctgg gggagcacgg atccaagaag gagtggagtc tttggctggc tatgcagaca 601 tctttctgag gaatgttacg gcatccggag tcatccctca gatttctctg atcatgggcc 661 catgtgctgg tggggccgtc tactccccag ccctaacaga cttcacgttc atggtaaagg 721 acacctccta cctgttcatc actggccctg atgttgtgaa gtctgtcacc aatgaggatg 781 ttacccagga ggagctcggt ggtgccaaga cccacaccac catgtcaggt gtggcccaca 841 gagcttttga aaatgatgtt gatgccttgt gtaatctccg ggatttcttc aactacctgc 901 ccctgagcag tcaggacccg gctcccgtcc gtgagtgcca cgatcccagt gaccgtctgg 961 ttcctgagct tgacacaatt gtccctttgg aatcaaccaa agcctacaac atggtggaca 1021 tcatacactc tgttgttgat gagcgtgaat tttttgagat catgcccaat tatgccaaga 1081 acatcattgt tggttttgca agaatgaatg ggaggactgt tggaattgtt ggcaaccaac 1141 ctaaggtggc ctcaggatgc ttggatatta attcatctgt gaaaggggct cgttttgtca 1201 gattctgtga tgcattcaat attccactca tcacttttgt tgatgtccct ggctttctac 1261 ctggcacagc acaggaatac gggggcatca tccggcatgg tgccaagctt ctctacgcat 1321 ttgctgaggc aactgtaccc aaagtcacag tcatcaccag gaaggcctat ggaggtgcct 1381 atgatgtcat gagctctaag cacctttgtg gtgataccaa ctatgcctgg cccaccgcag 1441 agattgcagt catgggagca aagggcgctg tggagaTCAT CTTCAAAGGG CATGAGAATG 1501 TGGAAGCTGC TCAGGCAGAG TACATCGAGA AGTTTGCCAA CCCTTTCCCT GCAGCAGTGC 1561 GAGGGTTTGT GGATGACATC ATCCAACCTT CTTCCACACG TGCCCGAATC TGCTGTGACC 1621 TGGATGTCTT GGCCAGCAAG AAGGTACAAC GTCCTTGGAG AAAACATGCA AATATTCCAT 1681 TGTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1741 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1801 GGCTTTATAT ATCTTGTGGA AAGGACGAGG CCCTATAACG GGCCCAATGT CCACGCGTTA 1861 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt