Transcript: Mouse NM_025841.4

Mus musculus KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (Kdelr2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Kdelr2 (66913)
Length:
1870
CDS:
143..781

Additional Resources:

NCBI RefSeq record:
NM_025841.4
NBCI Gene record:
Kdelr2 (66913)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025841.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093587 GACCATTCTCTACTGCGACTT pLKO.1 703 CDS 100% 4.050 5.670 N Kdelr2 n/a
2 TRCN0000093585 CCTATGATGGAAATCACGATA pLKO.1 396 CDS 100% 4.950 3.465 N Kdelr2 n/a
3 TRCN0000093586 CGTCATCCTACTGCTGAAGAT pLKO.1 190 CDS 100% 4.950 3.465 N Kdelr2 n/a
4 TRCN0000093588 GTGTACCTGATCTACATGAAA pLKO.1 365 CDS 100% 5.625 3.375 N Kdelr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025841.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07725 pDONR223 100% 90.5% 98.5% None (many diffs) n/a
2 ccsbBroad304_07725 pLX_304 0% 90.5% 98.5% V5 (many diffs) n/a
3 TRCN0000470175 CCCTCCATCAAGGGCTCCCCGGAG pLX_317 56.5% 90.5% 98.5% V5 (many diffs) n/a
4 ccsbBroadEn_07724 pDONR223 100% 90.5% 98.5% None (many diffs) n/a
5 ccsbBroad304_07724 pLX_304 0% 90.5% 98.5% V5 (many diffs) n/a
6 TRCN0000473876 AACGCCCTAACAGTGCAAAACAAT pLX_317 56.7% 90.5% 98.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV