Transcript: Mouse NM_025889.2

Mus musculus transmembrane protein 134 (Tmem134), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmem134 (66990)
Length:
1472
CDS:
67..609

Additional Resources:

NCBI RefSeq record:
NM_025889.2
NBCI Gene record:
Tmem134 (66990)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295697 TCGATGATGCCTTCGAGCTGA pLKO_005 95 CDS 100% 2.640 3.696 N Tmem134 n/a
2 TRCN0000125173 CGGTTCGAGGTGGCTGATGAA pLKO.1 193 CDS 100% 1.650 1.320 N Tmem134 n/a
3 TRCN0000295756 GTGCCCATGGTCACCATTATG pLKO_005 1045 3UTR 100% 13.200 9.240 N Tmem134 n/a
4 TRCN0000295758 TCTTCTACCTGCCCTACTTTG pLKO_005 581 CDS 100% 10.800 7.560 N Tmem134 n/a
5 TRCN0000125171 CTACCATGTGATCTTCATCTA pLKO.1 528 CDS 100% 4.950 3.465 N Tmem134 n/a
6 TRCN0000288432 CTACCATGTGATCTTCATCTA pLKO_005 528 CDS 100% 4.950 3.465 N Tmem134 n/a
7 TRCN0000295698 GTGTCTCCAGTGCCATCTTCT pLKO_005 473 CDS 100% 4.950 3.465 N Tmem134 n/a
8 TRCN0000125170 CCAACATCCTTTGATCCAGAA pLKO.1 402 CDS 100% 4.050 2.835 N Tmem134 n/a
9 TRCN0000125172 CCCAACATCCTTTGATCCAGA pLKO.1 401 CDS 100% 2.640 1.848 N Tmem134 n/a
10 TRCN0000125169 GCCTTAACTTATTCCTGGGTT pLKO.1 820 3UTR 100% 2.640 1.848 N Tmem134 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04185 pDONR223 100% 90.7% 93.8% None (many diffs) n/a
2 ccsbBroad304_04185 pLX_304 0% 90.7% 93.8% V5 (many diffs) n/a
3 TRCN0000468213 AACTTCGCGGTGAGAGAAACTACG pLX_317 82.2% 90.7% 93.8% V5 (many diffs) n/a
Download CSV