Transcript: Mouse NM_025892.2

Mus musculus centrosomal protein 19 (Cep19), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cep19 (66994)
Length:
1701
CDS:
423..914

Additional Resources:

NCBI RefSeq record:
NM_025892.2
NBCI Gene record:
Cep19 (66994)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264988 AGAGCTGCGGAACAGTTAAAG pLKO_005 561 CDS 100% 13.200 18.480 N Cep19 n/a
2 TRCN0000200630 CTGCGGAACAGTTAAAGAATA pLKO.1 565 CDS 100% 13.200 18.480 N Cep19 n/a
3 TRCN0000264987 CGTATCATGCCTGTCCGAAAC pLKO_005 516 CDS 100% 6.000 8.400 N Cep19 n/a
4 TRCN0000264984 CTGAAACACTAGCGATCTATA pLKO_005 964 3UTR 100% 13.200 10.560 N Cep19 n/a
5 TRCN0000264986 TCCAGCTGTGATCTTGATTTA pLKO_005 464 CDS 100% 13.200 9.240 N Cep19 n/a
6 TRCN0000264985 CCGAGGAAGACCTGAACAAAC pLKO_005 724 CDS 100% 10.800 7.560 N Cep19 n/a
7 TRCN0000201580 CCTGTGTTCTTCAGGACTCTA pLKO.1 1323 3UTR 100% 4.950 3.465 N Cep19 n/a
8 TRCN0000191941 GCAGAAACAATGGAACAGATT pLKO.1 681 CDS 100% 4.950 3.465 N Cep19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12898 pDONR223 100% 83.4% 85.2% None (many diffs) n/a
2 ccsbBroad304_12898 pLX_304 0% 83.4% 85.2% V5 (many diffs) n/a
3 TRCN0000466177 ATCTAAACCGTCTGAATTAATACA pLX_317 59.7% 83.4% 85.2% V5 (many diffs) n/a
Download CSV