Transcript: Mouse NM_025947.3

Mus musculus dynein light chain roadblock-type 1 (Dynlrb1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Dynlrb1 (67068)
Length:
702
CDS:
83..373

Additional Resources:

NCBI RefSeq record:
NM_025947.3
NBCI Gene record:
Dynlrb1 (67068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182214 CAATCCCACCACTACACAGTA pLKO.1 187 CDS 100% 4.950 6.930 N Dynlrb1 n/a
2 TRCN0000249421 CCTGTGTCATTCCTTAATTTA pLKO_005 390 3UTR 100% 15.000 12.000 N Dynlrb1 n/a
3 TRCN0000297365 CCTGTGTCATTCCTTAATTTA pLKO_005 390 3UTR 100% 15.000 12.000 N DYNLRB1 n/a
4 TRCN0000249423 GCCAACCTCATGCACAACTTC pLKO_005 209 CDS 100% 4.950 3.960 N Dynlrb1 n/a
5 TRCN0000249424 ATCCAGAATCCAACTGAATAA pLKO_005 353 CDS 100% 13.200 9.240 N Dynlrb1 n/a
6 TRCN0000249422 ATTATGGTGGCACCAGATAAA pLKO_005 314 CDS 100% 13.200 9.240 N Dynlrb1 n/a
7 TRCN0000249420 ATTCCCATCAAGAGCACAATG pLKO_005 164 CDS 100% 10.800 7.560 N Dynlrb1 n/a
8 TRCN0000197471 CCCAAGAATAATAGTGCTAAT pLKO.1 417 3UTR 100% 10.800 7.560 N Dynlrb1 n/a
9 TRCN0000375520 AGAATAATAGTGCTAATCATG pLKO_005 421 3UTR 100% 4.950 3.465 N Dynlrb1 n/a
10 TRCN0000375454 ATCATCGTGGTGAACACAGAA pLKO_005 140 CDS 100% 4.950 3.465 N Dynlrb1 n/a
11 TRCN0000156977 CAGAAGGCATTCCCATCAAGA pLKO.1 156 CDS 100% 4.950 3.465 N DYNLRB1 n/a
12 TRCN0000181962 CCTCATGCACAACTTCATCTT pLKO.1 214 CDS 100% 4.950 3.465 N Dynlrb1 n/a
13 TRCN0000217639 GTGATCCAGAATCCAACTGAA pLKO.1 350 CDS 100% 4.950 3.465 N Dynlrb1 n/a
14 TRCN0000375455 GGAGCACTGTGCGTGAGATTG pLKO_005 243 CDS 100% 3.600 2.520 N Dynlrb1 n/a
15 TRCN0000156511 GAACACAGAAGGCATTCCCAT pLKO.1 151 CDS 100% 2.640 1.848 N DYNLRB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09104 pDONR223 100% 90.9% 95.8% None (many diffs) n/a
2 ccsbBroad304_09104 pLX_304 0% 90.9% 95.8% V5 (many diffs) n/a
3 TRCN0000470696 GCATTTATTTACTCTGACATATGC pLX_317 60.3% 90.9% 95.8% V5 (many diffs) n/a
Download CSV