Transcript: Mouse NM_025970.3

Mus musculus zinc finger and BTB domain containing 8 opposite strand (Zbtb8os), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Zbtb8os (67106)
Length:
660
CDS:
18..521

Additional Resources:

NCBI RefSeq record:
NM_025970.3
NBCI Gene record:
Zbtb8os (67106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025970.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191963 GATTACAATTTGACGGAGGAA pLKO.1 45 CDS 100% 2.640 3.696 N Zbtb8os n/a
2 TRCN0000341017 GTTTGTGATCATCGACATTTA pLKO_005 500 CDS 100% 13.200 10.560 N Zbtb8os n/a
3 TRCN0000341018 ATACGGCTGATGTCCAGTTAC pLKO_005 124 CDS 100% 10.800 8.640 N Zbtb8os n/a
4 TRCN0000201547 CATACGGCTGATGTCCAGTTA pLKO.1 123 CDS 100% 4.950 3.960 N Zbtb8os n/a
5 TRCN0000200917 CTTTACAAGTTCAGCGCTGAT pLKO.1 306 CDS 100% 4.050 3.240 N Zbtb8os n/a
6 TRCN0000341019 CCGGGAAGTGAAAGTACTTAA pLKO_005 341 CDS 100% 13.200 9.240 N Zbtb8os n/a
7 TRCN0000215857 CGGGAAGTGAAAGTACTTAAT pLKO.1 342 CDS 100% 13.200 9.240 N Zbtb8os n/a
8 TRCN0000215420 GAACAGAAGTCAAGGCAATAA pLKO.1 436 CDS 100% 13.200 9.240 N Zbtb8os n/a
9 TRCN0000341093 AGGCGACCAAGGACAAGTATC pLKO_005 70 CDS 100% 10.800 7.560 N Zbtb8os n/a
10 TRCN0000200929 CATGGCCATGTTTGGTTACAT pLKO.1 188 CDS 100% 5.625 3.938 N Zbtb8os n/a
11 TRCN0000192439 CAGTCTCTGCTGTTTCACTTT pLKO.1 273 CDS 100% 4.950 3.465 N Zbtb8os n/a
12 TRCN0000192692 GTACTCAGCAATGCAAGTCTA pLKO.1 458 CDS 100% 4.950 3.465 N Zbtb8os n/a
13 TRCN0000341016 GTACTCAGCAATGCAAGTCTA pLKO_005 458 CDS 100% 4.950 3.465 N Zbtb8os n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025970.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13588 pDONR223 100% 73% 62.2% None (many diffs) n/a
2 ccsbBroad304_13588 pLX_304 0% 73% 62.2% V5 (many diffs) n/a
3 TRCN0000469966 TAAGGACCTGGCTTGGCCGCGGTA pLX_317 100% 73% 62.2% V5 (many diffs) n/a
Download CSV