Transcript: Mouse NM_025980.2

Mus musculus Notch-regulated ankyrin repeat protein (Nrarp), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Nrarp (67122)
Length:
2590
CDS:
354..698

Additional Resources:

NCBI RefSeq record:
NM_025980.2
NBCI Gene record:
Nrarp (67122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025980.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085117 CCAGTCAGTCATCGACGGCAA pLKO.1 521 CDS 100% 0.720 1.008 N Nrarp n/a
2 TRCN0000085114 GAACATGACTAACTGCGAATT pLKO.1 458 CDS 100% 0.000 0.000 N Nrarp n/a
3 TRCN0000334014 GAACATGACTAACTGCGAATT pLKO_005 458 CDS 100% 0.000 0.000 N Nrarp n/a
4 TRCN0000348110 GACTTCGGAATCCCGAGATAC pLKO_005 1008 3UTR 100% 10.800 8.640 N Nrarp n/a
5 TRCN0000085116 CGCGCTACACATCGCCGCTTT pLKO.1 611 CDS 100% 0.000 0.000 N Nrarp n/a
6 TRCN0000333939 CGCGCTACACATCGCCGCTTT pLKO_005 611 CDS 100% 0.000 0.000 N Nrarp n/a
7 TRCN0000085113 CCCTTCCTAGTGACTTCTATT pLKO.1 1618 3UTR 100% 13.200 9.240 N Nrarp n/a
8 TRCN0000348109 ACCAGGACATCGTGCTCTATC pLKO_005 640 CDS 100% 10.800 7.560 N Nrarp n/a
9 TRCN0000157750 CGTGCTCTATCTCATCACCAA pLKO.1 650 CDS 100% 2.640 1.848 N NRARP n/a
10 TRCN0000085115 CATGACTAACTGCGAATTCAA pLKO.1 461 CDS 100% 0.000 0.000 N Nrarp n/a
11 TRCN0000348175 TGGTGAAGCTGTTGGTCAAGT pLKO_005 550 CDS 100% 4.950 2.970 N Nrarp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025980.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05679 pDONR223 100% 93.8% 100% None (many diffs) n/a
2 ccsbBroad304_05679 pLX_304 0% 93.8% 100% V5 (many diffs) n/a
Download CSV