Transcript: Mouse NM_026034.4

Mus musculus armadillo repeat containing 10 (Armc10), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Armc10 (67211)
Length:
2014
CDS:
120..1040

Additional Resources:

NCBI RefSeq record:
NM_026034.4
NBCI Gene record:
Armc10 (67211)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026034.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182171 CAACCGACGATCCTGTCATTA pLKO.1 328 CDS 100% 13.200 18.480 N Armc10 n/a
2 TRCN0000282531 TCTGATCGGTTGCTCCTATTT pLKO_005 1036 CDS 100% 13.200 18.480 N Armc10 n/a
3 TRCN0000281583 GTGGAAGGCCGGTTAGCTAAT pLKO_005 885 CDS 100% 10.800 15.120 N Armc10 n/a
4 TRCN0000281584 TGACGGTCACCAACGACTATC pLKO_005 625 CDS 100% 10.800 15.120 N Armc10 n/a
5 TRCN0000176779 CAAGTAGCAAATGAGATTCTT pLKO.1 819 CDS 100% 5.625 7.875 N Armc10 n/a
6 TRCN0000178385 GCTCCTATGACGATATCTTAA pLKO.1 268 CDS 100% 13.200 10.560 N Armc10 n/a
7 TRCN0000282529 TTCCGAGGATGTGGATCATTT pLKO_005 1253 3UTR 100% 13.200 10.560 N Armc10 n/a
8 TRCN0000182624 GAGATTCTTCTTCGGGCTCTT pLKO.1 831 CDS 100% 4.050 3.240 N Armc10 n/a
9 TRCN0000263208 TCCACTAACCAGGCCATTATT pLKO_005 390 CDS 100% 15.000 10.500 N Armc10 n/a
10 TRCN0000200327 GCCATGCTCTTCAGGACTATT pLKO.1 1311 3UTR 100% 13.200 9.240 N Armc10 n/a
11 TRCN0000200104 CGATGGCTCCTATGACGATAT pLKO.1 263 CDS 100% 10.800 7.560 N Armc10 n/a
12 TRCN0000177942 GCTTTAGCAATAAAGCCGAAA pLKO.1 1014 CDS 100% 0.405 0.284 N Armc10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026034.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.