Transcript: Mouse NM_026070.3

Mus musculus WASH complex subunit 3 (Washc3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Washc3 (67282)
Length:
1048
CDS:
146..730

Additional Resources:

NCBI RefSeq record:
NM_026070.3
NBCI Gene record:
Washc3 (67282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026070.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176446 CAAACGGATCACATTCTGAAA pLKO.1 429 CDS 100% 4.950 6.930 N Washc3 n/a
2 TRCN0000197673 CCGTAGAAGAAAGTTCAGATA pLKO.1 687 CDS 100% 4.950 6.930 N Washc3 n/a
3 TRCN0000182823 CTGAAACCACTTCGGAGCAAA pLKO.1 444 CDS 100% 4.950 6.930 N Washc3 n/a
4 TRCN0000200374 GAAAGCGAAAGAGCCGTAGAA pLKO.1 674 CDS 100% 4.950 3.960 N Washc3 n/a
5 TRCN0000412633 TATCTAGCTCTCCGTGATAAA pLKO_005 796 3UTR 100% 13.200 9.240 N Washc3 n/a
6 TRCN0000424333 GATCCACGGTATGCCAGATAC pLKO_005 542 CDS 100% 10.800 7.560 N Washc3 n/a
7 TRCN0000177086 CAATATGGTTTGTTGACCAAA pLKO.1 897 3UTR 100% 4.950 3.465 N Washc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026070.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08195 pDONR223 100% 87.6% 89.6% None (many diffs) n/a
2 ccsbBroad304_08195 pLX_304 0% 87.6% 89.6% V5 (many diffs) n/a
3 TRCN0000473745 GAATACGAATTTGGGGTATACTTA pLX_317 93.5% 87.6% 89.6% V5 (many diffs) n/a
Download CSV