Transcript: Mouse NM_026112.4

Mus musculus zinc finger protein 606 (Zfp606), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-07-16
Taxon:
Mus musculus (mouse)
Gene:
Zfp606 (67370)
Length:
4736
CDS:
455..2839

Additional Resources:

NCBI RefSeq record:
NM_026112.4
NBCI Gene record:
Zfp606 (67370)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026112.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085248 CCCGAATGATAGAAGATAGAA pLKO.1 3420 3UTR 100% 5.625 7.875 N Zfp606 n/a
2 TRCN0000085252 CAAACTTCAAATTGGAGGAAA pLKO.1 1468 CDS 100% 4.950 3.960 N Zfp606 n/a
3 TRCN0000426559 GTCCACAAGGAATCCATATTT pLKO_005 3058 3UTR 100% 15.000 10.500 N Zfp606 n/a
4 TRCN0000432017 TAGTGGCGAGAAACGCTTTAT pLKO_005 2737 CDS 100% 13.200 9.240 N Zfp606 n/a
5 TRCN0000085250 CCAGTTAGAAATGTATCACAT pLKO.1 1003 CDS 100% 4.950 3.465 N Zfp606 n/a
6 TRCN0000016104 GCAGATAAGGTTACCTGTGAA pLKO.1 1226 CDS 100% 4.950 3.465 N ZNF606 n/a
7 TRCN0000085251 GCTCTTACCTTATTCAGCATA pLKO.1 1698 CDS 100% 4.950 3.465 N Zfp606 n/a
8 TRCN0000085249 GCCTTACTTCAACATCAGAAA pLKO.1 2795 CDS 100% 4.950 2.970 N Zfp606 n/a
9 TRCN0000225755 CCGGAGAGAAACCCTACAAAT pLKO_005 2655 CDS 100% 13.200 6.600 Y Zfp808 n/a
10 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1732 CDS 100% 13.200 6.600 Y Zfp977 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4571 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026112.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08999 pDONR223 100% 88.6% 89% None (many diffs) n/a
2 ccsbBroad304_08999 pLX_304 0% 88.6% 89% V5 (many diffs) n/a
Download CSV