Transcript: Mouse NM_026138.2

Mus musculus SOGA family member 3 (Soga3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Soga3 (67412)
Length:
3948
CDS:
536..3373

Additional Resources:

NCBI RefSeq record:
NM_026138.2
NBCI Gene record:
Soga3 (67412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377020 GCACGCATCTACGTGGCTAAT pLKO_005 3056 CDS 100% 10.800 15.120 N Soga3 n/a
2 TRCN0000184325 GCGAAGACTTCAATGGCTCTT pLKO.1 2400 CDS 100% 4.050 5.670 N Soga3 n/a
3 TRCN0000376947 ATGGACAAAGTCTCATAATTA pLKO_005 3711 3UTR 100% 15.000 10.500 N Soga3 n/a
4 TRCN0000215379 CTGTAGGAATTGAGTATTATT pLKO.1 3734 3UTR 100% 15.000 10.500 N Soga3 n/a
5 TRCN0000244542 GTGCCAGCTACAGTTCGTTAA pLKO_005 2107 CDS 100% 10.800 7.560 N Soga3 n/a
6 TRCN0000130240 CATCCAGTTCCATCTCAAGAA pLKO.1 1309 CDS 100% 4.950 3.465 N SOGA3 n/a
7 TRCN0000128478 GCTCAACAAGTACAAGTACAA pLKO.1 2557 CDS 100% 4.950 3.465 N SOGA3 n/a
8 TRCN0000184654 GCAGGATCTCAAGGTTGCAAA pLKO.1 1843 CDS 100% 4.950 2.970 N Soga3 n/a
9 TRCN0000216188 CTCATCTTACACTGTCAAATT pLKO.1 3545 3UTR 100% 13.200 6.600 Y Soga3 n/a
10 TRCN0000244543 AGATGTTCCAGCCCATCATTC pLKO_005 3261 CDS 100% 10.800 5.400 Y Soga3 n/a
11 TRCN0000130008 GCAAAGCAAGCTTTACAGAAT pLKO.1 1973 CDS 100% 4.950 3.465 N SOGA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.