Transcript: Mouse NM_026149.4

Mus musculus NudC domain containing 1 (Nudcd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nudcd1 (67429)
Length:
3447
CDS:
532..2280

Additional Resources:

NCBI RefSeq record:
NM_026149.4
NBCI Gene record:
Nudcd1 (67429)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026149.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216425 GAGTAAATACGGAGAATTAAT pLKO.1 2261 CDS 100% 15.000 10.500 N Nudcd1 n/a
2 TRCN0000217640 GGCAGCACATGGACAATTAAA pLKO.1 1525 CDS 100% 15.000 10.500 N Nudcd1 n/a
3 TRCN0000176537 CAGTGTCTACTACATTGATAA pLKO.1 747 CDS 100% 13.200 9.240 N Nudcd1 n/a
4 TRCN0000320266 CAGTGTCTACTACATTGATAA pLKO_005 747 CDS 100% 13.200 9.240 N Nudcd1 n/a
5 TRCN0000177122 GCATGTAATGCTCAAGAATTA pLKO.1 1729 CDS 100% 13.200 9.240 N Nudcd1 n/a
6 TRCN0000350311 GCATGTAATGCTCAAGAATTA pLKO_005 1729 CDS 100% 13.200 9.240 N Nudcd1 n/a
7 TRCN0000217757 CCTAATGGAAATGGTCTAATG pLKO.1 1240 CDS 100% 10.800 7.560 N Nudcd1 n/a
8 TRCN0000216945 CTTCCAGAAAGCAGTACTAAG pLKO.1 1405 CDS 100% 10.800 7.560 N Nudcd1 n/a
9 TRCN0000178295 GTGCCACATTATGCTGCAATT pLKO.1 1216 CDS 100% 10.800 7.560 N Nudcd1 n/a
10 TRCN0000320341 GTGCCACATTATGCTGCAATT pLKO_005 1216 CDS 100% 10.800 7.560 N Nudcd1 n/a
11 TRCN0000198441 GCTACGTCTAAACAGACAGTA pLKO.1 3150 3UTR 100% 4.950 3.465 N Nudcd1 n/a
12 TRCN0000181623 GCTGGAGAGTTAGCAGTTCAA pLKO.1 2909 3UTR 100% 4.950 3.465 N Nudcd1 n/a
13 TRCN0000320267 GCTGGAGAGTTAGCAGTTCAA pLKO_005 2909 3UTR 100% 4.950 3.465 N Nudcd1 n/a
14 TRCN0000198430 GCTTCCTGACATCATACAGAA pLKO.1 3041 3UTR 100% 4.950 3.465 N Nudcd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026149.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12893 pDONR223 100% 75.4% 74.7% None (many diffs) n/a
2 ccsbBroad304_12893 pLX_304 0% 75.4% 74.7% V5 (many diffs) n/a
Download CSV