Transcript: Mouse NM_026167.4

Mus musculus kelch-like 13 (Klhl13), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Klhl13 (67455)
Length:
3251
CDS:
241..2157

Additional Resources:

NCBI RefSeq record:
NM_026167.4
NBCI Gene record:
Klhl13 (67455)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026167.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216641 CTGACAATACTTGCGTCAATT pLKO.1 1100 CDS 100% 13.200 18.480 N Klhl13 n/a
2 TRCN0000192099 CGTCGATACAGTGTTTAGATT pLKO.1 1410 CDS 100% 5.625 7.875 N Klhl13 n/a
3 TRCN0000190762 GCTGTGAATACTACTCACCTA pLKO.1 1856 CDS 100% 2.640 3.696 N Klhl13 n/a
4 TRCN0000215652 GATCCAAGTTGCATCTTTAAA pLKO.1 1452 CDS 100% 15.000 12.000 N Klhl13 n/a
5 TRCN0000202289 GCCGTTTATGCAGCCAGTTAT pLKO.1 1152 CDS 100% 13.200 10.560 N Klhl13 n/a
6 TRCN0000190389 CCATCTGACAGAAGTGGATAA pLKO.1 807 CDS 100% 10.800 7.560 N Klhl13 n/a
7 TRCN0000189744 GCAGGAAGTACACGCATCTTT pLKO.1 376 CDS 100% 5.625 3.938 N Klhl13 n/a
8 TRCN0000192007 CCTTCAGTAATTGATACAGAA pLKO.1 2254 3UTR 100% 4.950 3.465 N Klhl13 n/a
9 TRCN0000135888 GAATGGACCTATGTTGCCAAA pLKO.1 1588 CDS 100% 4.050 2.835 N KLHL13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026167.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08613 pDONR223 100% 79.7% 85.6% None (many diffs) n/a
2 ccsbBroad304_08613 pLX_304 0% 79.7% 85.6% V5 (many diffs) n/a
3 TRCN0000480620 CGGATATTAATTAGCAACCTAAAC pLX_317 19.4% 79.7% 85.6% V5 (many diffs) n/a
Download CSV