Transcript: Mouse NM_026191.2

Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 40 (Dhx40), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Dhx40 (67487)
Length:
3724
CDS:
112..2451

Additional Resources:

NCBI RefSeq record:
NM_026191.2
NBCI Gene record:
Dhx40 (67487)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113038 GCGGAGTCTGTTGACTATGAT pLKO.1 997 CDS 100% 5.625 7.875 N Dhx40 n/a
2 TRCN0000113036 CGGAGTCTGTTGACTATGATT pLKO.1 998 CDS 100% 5.625 3.938 N Dhx40 n/a
3 TRCN0000113035 CCAGGAAATGTGCTTCTGTTT pLKO.1 2488 3UTR 100% 4.950 3.465 N Dhx40 n/a
4 TRCN0000113037 GCAATCAAATACATGACTGAT pLKO.1 544 CDS 100% 4.950 3.465 N Dhx40 n/a
5 TRCN0000113039 CCCAAGTTGCATGAACTTAAT pLKO.1 2200 CDS 100% 1.320 0.924 N Dhx40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04103 pDONR223 100% 91.5% 97.5% None (many diffs) n/a
2 ccsbBroad304_04103 pLX_304 0% 91.5% 97.5% V5 (many diffs) n/a
3 TRCN0000471261 CTTACCCAGAGGAGATCAAATCAA pLX_317 13.6% 91.5% 97.5% V5 (many diffs) n/a
Download CSV