Transcript: Mouse NM_026248.3

Mus musculus RIKEN cDNA 4930430A15 gene (4930430A15Rik), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
4930430A15Rik (67575)
Length:
1838
CDS:
189..1646

Additional Resources:

NCBI RefSeq record:
NM_026248.3
NBCI Gene record:
4930430A15Rik (67575)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085302 GCTGGATATTTCTAAGTATGT pLKO.1 1133 CDS 100% 4.950 3.960 N 4930430A15Rik n/a
2 TRCN0000421650 GCTATTGAAGGCACAAGTAAA pLKO_005 939 CDS 100% 13.200 9.240 N 4930430A15Rik n/a
3 TRCN0000426296 AGATAAACAACTACTGGTATA pLKO_005 1625 CDS 100% 10.800 7.560 N 4930430A15Rik n/a
4 TRCN0000435613 ATAACCAGACACTCGCCAAAT pLKO_005 655 CDS 100% 10.800 7.560 N 4930430A15Rik n/a
5 TRCN0000414502 ATGAGAATGCATGCAAGTTTG pLKO_005 1105 CDS 100% 10.800 7.560 N 4930430A15Rik n/a
6 TRCN0000085299 CCAGGTGGAAGTAGTAAGTAT pLKO.1 458 CDS 100% 5.625 3.938 N 4930430A15Rik n/a
7 TRCN0000085298 GCCAGGTGGAAGTAGTAAGTA pLKO.1 457 CDS 100% 5.625 3.938 N 4930430A15Rik n/a
8 TRCN0000085300 CGAGATACAAACCTCTCAGAA pLKO.1 310 CDS 100% 4.950 3.465 N 4930430A15Rik n/a
9 TRCN0000085301 CGGAATCAGCTCATTTCATAA pLKO.1 1549 CDS 100% 13.200 7.920 N 4930430A15Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.