Transcript: Mouse NM_026267.2

Mus musculus NECAP endocytosis associated 1 (Necap1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Necap1 (67602)
Length:
2393
CDS:
13..840

Additional Resources:

NCBI RefSeq record:
NM_026267.2
NBCI Gene record:
Necap1 (67602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175177 CATCAAATTGAGTATTGGGAA pLKO.1 486 CDS 100% 2.640 3.696 N Necap1 n/a
2 TRCN0000193489 GACTTTAATGTTTCCCTGCAA pLKO.1 364 CDS 100% 2.640 3.696 N Necap1 n/a
3 TRCN0000175176 CGATACAAACACTAAGAAGAA pLKO.1 2181 3UTR 100% 4.950 3.960 N Necap1 n/a
4 TRCN0000219585 ATCGTCCCAAGTTGGATTTAG pLKO.1 446 CDS 100% 13.200 9.240 N Necap1 n/a
5 TRCN0000175480 CCTTTGTTTGTTGGGCAGTTT pLKO.1 1959 3UTR 100% 4.950 3.465 N Necap1 n/a
6 TRCN0000194480 GCAGCATCTTTGACCAGTGAA pLKO.1 1469 3UTR 100% 4.950 3.465 N Necap1 n/a
7 TRCN0000175753 GCTCCATGTAATTGCTGCATT pLKO.1 1564 3UTR 100% 4.950 3.465 N Necap1 n/a
8 TRCN0000194318 CGTAGAACAGTATCCTGGGAT pLKO.1 231 CDS 100% 2.640 1.848 N Necap1 n/a
9 TRCN0000173347 GCAAGATCACTTCAAGTGGGT pLKO.1 381 CDS 100% 0.660 0.462 N Necap1 n/a
10 TRCN0000174369 CAGGAAACTGAGATTTCCAAA pLKO.1 406 CDS 100% 0.495 0.347 N Necap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11795 pDONR223 100% 43% 43.6% None (many diffs) n/a
2 ccsbBroad304_11795 pLX_304 0% 43% 43.6% V5 (many diffs) n/a
3 TRCN0000474257 CTCTCACCCCTGCTGTGTTTGGCC pLX_317 90.6% 43% 43.6% V5 (many diffs) n/a
Download CSV