Transcript: Mouse NM_026298.5

Mus musculus intraflagellar transport 172 (Ift172), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ift172 (67661)
Length:
5440
CDS:
103..5352

Additional Resources:

NCBI RefSeq record:
NM_026298.5
NBCI Gene record:
Ift172 (67661)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026298.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079813 GCGGCCATCAACCACTATATT pLKO.1 2716 CDS 100% 15.000 21.000 N Ift172 n/a
2 TRCN0000325790 GCGGCCATCAACCACTATATT pLKO_005 2716 CDS 100% 15.000 21.000 N Ift172 n/a
3 TRCN0000079816 CCAGTGGAAGAAGGCAATTTA pLKO.1 2784 CDS 100% 15.000 10.500 N Ift172 n/a
4 TRCN0000325867 CCAGTGGAAGAAGGCAATTTA pLKO_005 2784 CDS 100% 15.000 10.500 N Ift172 n/a
5 TRCN0000079814 GCTGCTGATCTCTCATTACTA pLKO.1 4704 CDS 100% 5.625 3.938 N Ift172 n/a
6 TRCN0000325793 GCTGCTGATCTCTCATTACTA pLKO_005 4704 CDS 100% 5.625 3.938 N Ift172 n/a
7 TRCN0000136890 CATAGGACAGACTGACAACAT pLKO.1 348 CDS 100% 4.950 3.465 N IFT172 n/a
8 TRCN0000079817 CGGTTCTTGGATCTGACTGAT pLKO.1 4897 CDS 100% 4.950 3.465 N Ift172 n/a
9 TRCN0000325792 CGGTTCTTGGATCTGACTGAT pLKO_005 4897 CDS 100% 4.950 3.465 N Ift172 n/a
10 TRCN0000079815 GCTTATGTGTATGGTACAATA pLKO.1 1736 CDS 100% 13.200 7.920 N Ift172 n/a
11 TRCN0000325868 GCTTATGTGTATGGTACAATA pLKO_005 1736 CDS 100% 13.200 7.920 N Ift172 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026298.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.