Transcript: Mouse NM_026374.3

Mus musculus interleukin enhancer binding factor 2 (Ilf2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ilf2 (67781)
Length:
1973
CDS:
41..1213

Additional Resources:

NCBI RefSeq record:
NM_026374.3
NBCI Gene record:
Ilf2 (67781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304647 CCGGCAGGTAGGATCATATAA pLKO_005 346 CDS 100% 15.000 21.000 N Ilf2 n/a
2 TRCN0000066746 GCTGACTAATGAAACTGGCTT pLKO.1 511 CDS 100% 2.640 3.696 N Ilf2 n/a
3 TRCN0000066745 GCTATCTTGCTTCTGAAATAT pLKO.1 1050 CDS 100% 15.000 12.000 N Ilf2 n/a
4 TRCN0000302157 GCTATCTTGCTTCTGAAATAT pLKO_005 1050 CDS 100% 15.000 12.000 N Ilf2 n/a
5 TRCN0000304645 TGCCACACATTCCCAATATTT pLKO_005 1424 3UTR 100% 15.000 12.000 N Ilf2 n/a
6 TRCN0000066747 CCACAGTTAAAGTTCTCATAA pLKO.1 693 CDS 100% 13.200 9.240 N Ilf2 n/a
7 TRCN0000304646 TGACCTGGTGGTAATACTAAA pLKO_005 400 CDS 100% 13.200 9.240 N Ilf2 n/a
8 TRCN0000066744 GCAGGCTTCCATCCTTTCTTT pLKO.1 250 CDS 100% 5.625 3.938 N Ilf2 n/a
9 TRCN0000302231 GCAGGCTTCCATCCTTTCTTT pLKO_005 250 CDS 100% 5.625 3.938 N Ilf2 n/a
10 TRCN0000066743 GCTGGTTTGAAGAGAACGCTT pLKO.1 666 CDS 100% 2.640 1.848 N Ilf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00865 pDONR223 100% 91.5% 100% None (many diffs) n/a
2 ccsbBroad304_00865 pLX_304 0% 91.5% 100% V5 (many diffs) n/a
3 TRCN0000469482 GGTGATCGACTTGTCTACCCGGCA pLX_317 30.2% 91.5% 100% V5 (many diffs) n/a
Download CSV