Transcript: Mouse NM_026376.3

Mus musculus plexin D1 (Plxnd1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Plxnd1 (67784)
Length:
6913
CDS:
201..5978

Additional Resources:

NCBI RefSeq record:
NM_026376.3
NBCI Gene record:
Plxnd1 (67784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314143 GACCGTACAGCGCTATTATAA pLKO_005 5699 CDS 100% 15.000 21.000 N Plxnd1 n/a
2 TRCN0000350171 TCTACGACTGCAGCCGAATTG pLKO_005 2302 CDS 100% 10.800 15.120 N Plxnd1 n/a
3 TRCN0000078775 CCGGAACTTGAACGTGTCCTT pLKO.1 4865 CDS 100% 2.640 3.696 N Plxnd1 n/a
4 TRCN0000314200 ATCGCTGCCAGTCCCTAATAA pLKO_005 6222 3UTR 100% 15.000 10.500 N Plxnd1 n/a
5 TRCN0000078777 CCTGTAGACTTCTTCATCAAT pLKO.1 3612 CDS 100% 5.625 3.938 N Plxnd1 n/a
6 TRCN0000061550 CCTCACGGACAACTACAACAA pLKO.1 563 CDS 100% 4.950 3.465 N PLXND1 n/a
7 TRCN0000078776 CGAGCAGTTCTTCGCTGTCTT pLKO.1 1301 CDS 100% 4.950 3.465 N Plxnd1 n/a
8 TRCN0000078773 GCCAGTCCCTAATAAGACTTT pLKO.1 6228 3UTR 100% 4.950 3.465 N Plxnd1 n/a
9 TRCN0000078774 CGGCTCAGTGATGTGGCACAT pLKO.1 2961 CDS 100% 1.350 0.945 N Plxnd1 n/a
10 TRCN0000317940 CGGCTCAGTGATGTGGCACAT pLKO_005 2961 CDS 100% 1.350 0.945 N Plxnd1 n/a
11 TRCN0000350170 ACGGCAAGCTGGAGTACTATA pLKO_005 4558 CDS 100% 13.200 7.920 N Plxnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.