Transcript: Mouse NM_026384.3

Mus musculus diacylglycerol O-acyltransferase 2 (Dgat2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dgat2 (67800)
Length:
2251
CDS:
202..1368

Additional Resources:

NCBI RefSeq record:
NM_026384.3
NBCI Gene record:
Dgat2 (67800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026384.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125477 CTGATCTGGTTCCCACTTATT pLKO.1 1013 CDS 100% 13.200 18.480 N Dgat2 n/a
2 TRCN0000313281 GCTACTTCCGAGACTACTTTC pLKO_005 602 CDS 100% 10.800 15.120 N Dgat2 n/a
3 TRCN0000125475 CCAGGAACTATATCTTTGGAT pLKO.1 659 CDS 100% 3.000 2.400 N Dgat2 n/a
4 TRCN0000349433 CCAGGAACTATATCTTTGGAT pLKO_005 659 CDS 100% 3.000 2.400 N Dgat2 n/a
5 TRCN0000349881 ATGGGTGTCTGTGGGTTATTT pLKO_005 1464 3UTR 100% 15.000 10.500 N Dgat2 n/a
6 TRCN0000005195 GCTGACCACCAGGAACTATAT pLKO.1 651 CDS 100% 13.200 9.240 N DGAT2 n/a
7 TRCN0000313280 TCCTGGCATAAGGCCCTATTT pLKO_005 756 CDS 100% 13.200 9.240 N Dgat2 n/a
8 TRCN0000125476 CTTTGGAGAGAATGAGGTATA pLKO.1 1035 CDS 100% 10.800 7.560 N Dgat2 n/a
9 TRCN0000312262 CTTTGGAGAGAATGAGGTATA pLKO_005 1035 CDS 100% 10.800 7.560 N Dgat2 n/a
10 TRCN0000125474 CCATTGCAATGTTAGATGTTT pLKO.1 1508 3UTR 100% 5.625 3.938 N Dgat2 n/a
11 TRCN0000125478 CAGCAAGAAGTTTCCTGGCAT pLKO.1 744 CDS 100% 2.640 1.848 N Dgat2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026384.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04407 pDONR223 100% 89.5% 95.1% None (many diffs) n/a
2 ccsbBroad304_04407 pLX_304 0% 89.5% 95.1% V5 (many diffs) n/a
3 TRCN0000468638 GACTATGGAAAGAGTCTCTTCATG pLX_317 39.1% 89.5% 95.1% V5 (many diffs) n/a
Download CSV