Transcript: Mouse NM_026412.3

Mus musculus kinetochore-localized astrin/SPAG5 binding (Knstrn), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Knstrn (51944)
Length:
3118
CDS:
99..1037

Additional Resources:

NCBI RefSeq record:
NM_026412.3
NBCI Gene record:
Knstrn (51944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191181 CCCTTAGAACTAGGATACTAA pLKO.1 1281 3UTR 100% 5.625 7.875 N Knstrn n/a
2 TRCN0000319898 CCCTTAGAACTAGGATACTAA pLKO_005 1281 3UTR 100% 5.625 7.875 N Knstrn n/a
3 TRCN0000201497 CCTTATGTAAGGACGAAGCCA pLKO.1 967 CDS 100% 0.750 1.050 N Knstrn n/a
4 TRCN0000319897 CCTTATGTAAGGACGAAGCCA pLKO_005 967 CDS 100% 0.750 1.050 N Knstrn n/a
5 TRCN0000216519 GACTTCACAATAATCCTAGAG pLKO.1 990 CDS 100% 4.050 3.240 N Knstrn n/a
6 TRCN0000200545 CCTTAGAACTAGGATACTAAA pLKO.1 1282 3UTR 100% 13.200 9.240 N Knstrn n/a
7 TRCN0000192624 GCTGCGGAGCATTATTTGAAA pLKO.1 246 CDS 100% 5.625 3.938 N Knstrn n/a
8 TRCN0000350130 GCTGCGGAGCATTATTTGAAA pLKO_005 246 CDS 100% 5.625 3.938 N Knstrn n/a
9 TRCN0000217293 GCGGATTTGCTTAGACATCTT pLKO.1 447 CDS 100% 4.950 3.465 N Knstrn n/a
10 TRCN0000200854 GCTACTTCTAAACTACCTGTT pLKO.1 414 CDS 100% 4.050 2.835 N Knstrn n/a
11 TRCN0000319827 GCTACTTCTAAACTACCTGTT pLKO_005 414 CDS 100% 4.050 2.835 N Knstrn n/a
12 TRCN0000191452 CTCGAAACTTTGAAAGACGAA pLKO.1 837 CDS 100% 2.640 1.848 N Knstrn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.