Transcript: Mouse NM_026414.2

Mus musculus aspartic peptidase, retroviral-like 1 (Asprv1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Asprv1 (67855)
Length:
1550
CDS:
1..1020

Additional Resources:

NCBI RefSeq record:
NM_026414.2
NBCI Gene record:
Asprv1 (67855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030514 CCTGGATACTCTTCGTCCTTT pLKO.1 690 CDS 100% 4.950 6.930 N Asprv1 n/a
2 TRCN0000030518 AGAGGCTATTATTGGCACAGA pLKO.1 834 CDS 100% 2.640 3.696 N Asprv1 n/a
3 TRCN0000030515 CCAGCGCAGAAGAGGCTATTA pLKO.1 824 CDS 100% 13.200 9.240 N Asprv1 n/a
4 TRCN0000030516 GACCTGGAGCTTATTGAGGAA pLKO.1 964 CDS 100% 2.640 1.848 N Asprv1 n/a
5 TRCN0000030517 CACAGAAATTAGCCTGGGCAA pLKO.1 768 CDS 100% 2.160 1.512 N Asprv1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13278 pDONR223 100% 35.1% 39% None (many diffs) n/a
2 ccsbBroad304_13278 pLX_304 0% 35.1% 39% V5 (many diffs) n/a
3 TRCN0000472573 CGTTTGAATTCCCGACATATAATT pLX_317 84.8% 35.1% 39% V5 (many diffs) n/a
Download CSV