Transcript: Mouse NM_026424.3

Mus musculus coenzyme Q10B (Coq10b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Coq10b (67876)
Length:
1598
CDS:
106..684

Additional Resources:

NCBI RefSeq record:
NM_026424.3
NBCI Gene record:
Coq10b (67876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258125 CAAACATACCTCGGGAATTAA pLKO_005 638 CDS 100% 15.000 10.500 N Coq10b n/a
2 TRCN0000425920 CAATCATTTGGAGACTATTTG pLKO_005 441 CDS 100% 13.200 9.240 N COQ10B n/a
3 TRCN0000250999 TCAATCATTTGGAGACTATTT pLKO_005 440 CDS 100% 13.200 9.240 N Coq10b n/a
4 TRCN0000251000 TGTTGCTAGGATACCACATTC pLKO_005 935 3UTR 100% 10.800 7.560 N Coq10b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04192 pDONR223 100% 67.5% 68.7% None (many diffs) n/a
2 ccsbBroad304_04192 pLX_304 0% 67.5% 68.7% V5 (many diffs) n/a
3 TRCN0000478429 ACCCAACCAGGGGATCCGATGCCT pLX_317 53.8% 67.5% 68.7% V5 (many diffs) n/a
Download CSV