Transcript: Mouse NM_026436.3

Mus musculus transmembrane protein 86A (Tmem86a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem86a (67893)
Length:
1791
CDS:
142..867

Additional Resources:

NCBI RefSeq record:
NM_026436.3
NBCI Gene record:
Tmem86a (67893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250486 TGGCTCATGGTGTTCGGTTTC pLKO_005 305 CDS 100% 6.000 8.400 N Tmem86a n/a
2 TRCN0000250487 CCAAACTGGTGCCCTTCTTTA pLKO_005 179 CDS 100% 13.200 9.240 N Tmem86a n/a
3 TRCN0000265271 GGGCCAGTCTCCAACTATATG pLKO_005 1514 3UTR 100% 13.200 9.240 N Tmem86a n/a
4 TRCN0000175400 CTGATCATGTCTACCTACTAT pLKO.1 763 CDS 100% 5.625 3.938 N Tmem86a n/a
5 TRCN0000250485 CTGATCATGTCTACCTACTAT pLKO_005 763 CDS 100% 5.625 3.938 N Tmem86a n/a
6 TRCN0000250484 TGGCAGGACCACGGATACTTT pLKO_005 400 CDS 100% 5.625 3.938 N Tmem86a n/a
7 TRCN0000173211 CTTTAAGGCTACCTGTGTGTA pLKO.1 195 CDS 100% 4.950 3.465 N Tmem86a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09608 pDONR223 100% 86.9% 88.3% None (many diffs) n/a
2 ccsbBroad304_09608 pLX_304 0% 86.9% 88.3% V5 (many diffs) n/a
3 TRCN0000466559 CCCCAAAAACTATTTTTTATTCCA pLX_317 51.2% 86.9% 88.3% V5 (many diffs) n/a
Download CSV