Transcript: Mouse NM_026448.3

Mus musculus kelch-like 7 (Klhl7), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Klhl7 (52323)
Length:
3427
CDS:
166..1926

Additional Resources:

NCBI RefSeq record:
NM_026448.3
NBCI Gene record:
Klhl7 (52323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249381 GGGCATATCCTTGAGTATAAT pLKO_005 1792 CDS 100% 15.000 21.000 N Klhl7 n/a
2 TRCN0000249379 TACAAGCTGAACCACTTATTC pLKO_005 905 CDS 100% 13.200 10.560 N Klhl7 n/a
3 TRCN0000249383 AGATGCTGAACCTGATATTAT pLKO_005 429 CDS 100% 15.000 10.500 N Klhl7 n/a
4 TRCN0000249380 CCAGCCATTCATGGTTGATAT pLKO_005 831 CDS 100% 13.200 9.240 N Klhl7 n/a
5 TRCN0000249382 TAAGCTTAGCACCCATCATTA pLKO_005 2557 3UTR 100% 13.200 9.240 N Klhl7 n/a
6 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 3296 3UTR 100% 2.640 1.320 Y BC028528 n/a
7 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 3288 3UTR 100% 13.200 6.600 Y Ptcra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15920 pDONR223 0% 20.8% 19.4% None (many diffs) n/a
2 ccsbBroad304_15920 pLX_304 0% 20.8% 19.4% V5 (many diffs) n/a
3 TRCN0000477622 CTAGAGAGATTTAGCCCGCTCTCA pLX_317 92% 20.8% 19.4% V5 (many diffs) n/a
Download CSV