Transcript: Mouse NM_026484.3

Mus musculus cyclin Y (Ccny), mRNA.

Source:
NCBI, updated 2017-04-30
Taxon:
Mus musculus (mouse)
Gene:
Ccny (67974)
Length:
4017
CDS:
480..1505

Additional Resources:

NCBI RefSeq record:
NM_026484.3
NBCI Gene record:
Ccny (67974)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106082 CGACGATTTAAACATGGAATT pLKO.1 629 CDS 100% 0.000 0.000 N Ccny n/a
2 TRCN0000448350 CCGAAGTGCCACCTGATTATG pLKO_005 943 CDS 100% 13.200 10.560 N Ccny n/a
3 TRCN0000106083 CTCTTGACATACGCAGAGATT pLKO.1 1074 CDS 100% 4.950 3.960 N Ccny n/a
4 TRCN0000106084 GCCAATTGGAAGCGCATTGTT pLKO.1 1107 CDS 100% 5.625 3.938 N Ccny n/a
5 TRCN0000106081 GCGATATATTACCACATCAAA pLKO.1 855 CDS 100% 5.625 3.938 N Ccny n/a
6 TRCN0000106080 GCCAAATATGAATGCCTCTTA pLKO.1 3465 3UTR 100% 4.950 3.465 N Ccny n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05228 pDONR223 100% 77% 82.4% None (many diffs) n/a
2 ccsbBroad304_05228 pLX_304 0% 77% 82.4% V5 (many diffs) n/a
3 TRCN0000492295 CACGAGTGGCAGCAAAAACTGTGA pLX_317 45.2% 77% 82.4% V5 (many diffs) n/a
Download CSV