Transcript: Mouse NM_026489.3

Mus musculus HORMA domain containing 1 (Hormad1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Hormad1 (67981)
Length:
1700
CDS:
65..1189

Additional Resources:

NCBI RefSeq record:
NM_026489.3
NBCI Gene record:
Hormad1 (67981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241076 GTGACTGTGAAGGAGTAATAT pLKO_005 654 CDS 100% 15.000 10.500 N Hormad1 n/a
2 TRCN0000216552 GATGATCATTCTAGCTGTATA pLKO.1 352 CDS 100% 13.200 9.240 N Hormad1 n/a
3 TRCN0000241075 TCAACTGAGCATCAATCTTTG pLKO_005 128 CDS 100% 10.800 7.560 N Hormad1 n/a
4 TRCN0000191823 GATGTTTGTCTGACCATGAAA pLKO.1 575 CDS 100% 5.625 3.938 N Hormad1 n/a
5 TRCN0000241079 AGAGAAGTCTTCGTCAATTTA pLKO_005 1137 CDS 100% 15.000 9.000 N Hormad1 n/a
6 TRCN0000241077 AGTATCTTGCATCACCTATTT pLKO_005 178 CDS 100% 13.200 7.920 N Hormad1 n/a
7 TRCN0000215630 GTATCTTGCATCACCTATTTG pLKO.1 179 CDS 100% 13.200 7.920 N Hormad1 n/a
8 TRCN0000241078 TGCCCTGGACTTGGAGTTAAA pLKO_005 1199 3UTR 100% 13.200 7.920 N Hormad1 n/a
9 TRCN0000217037 CACGTCTTGGAATCTAGTCAA pLKO.1 1227 3UTR 100% 4.950 2.970 N Hormad1 n/a
10 TRCN0000200876 GAAGAGAAGTCTTCGTCAATT pLKO.1 1135 CDS 100% 1.320 0.792 N Hormad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026489.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04324 pDONR223 100% 80.1% 73.2% None (many diffs) n/a
2 ccsbBroad304_04324 pLX_304 0% 80.1% 73.2% V5 (many diffs) n/a
3 TRCN0000467613 TTACTACGCCACGTAACAACTCTT pLX_317 36% 80.1% 73.2% V5 (many diffs) n/a
Download CSV