Transcript: Mouse NM_026515.2

Mus musculus PCNA clamp associated factor (Pclaf), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pclaf (68026)
Length:
2387
CDS:
107..439

Additional Resources:

NCBI RefSeq record:
NM_026515.2
NBCI Gene record:
Pclaf (68026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197473 CCATATTGTTATGGCATGTTT pLKO.1 770 3UTR 100% 0.563 0.788 N Pclaf n/a
2 TRCN0000176813 GCCATATTGTTATGGCATGTT pLKO.1 769 3UTR 100% 0.495 0.693 N Pclaf n/a
3 TRCN0000215953 CATTCAGTTCGTTATCATAAA pLKO.1 1325 3UTR 100% 13.200 9.240 N Pclaf n/a
4 TRCN0000216084 CAAGATGACTTGAGATCATTG pLKO.1 1557 3UTR 100% 10.800 7.560 N Pclaf n/a
5 TRCN0000198104 CAACCTGATCACAGAGATGAT pLKO.1 407 CDS 100% 4.950 3.465 N Pclaf n/a
6 TRCN0000182422 GCTCCTCCTTTCTTACCTGTT pLKO.1 638 3UTR 100% 4.050 2.835 N Pclaf n/a
7 TRCN0000182421 GTCCTTTGCAACCTGATCACA pLKO.1 399 CDS 100% 3.000 2.100 N Pclaf n/a
8 TRCN0000178616 CCACCTTTGTCACCAATTCTT pLKO.1 192 CDS 100% 5.625 3.375 N Pclaf n/a
9 TRCN0000197419 CCTTTGTCACCAATTCTTCAA pLKO.1 195 CDS 100% 4.950 2.970 N Pclaf n/a
10 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 2236 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02238 pDONR223 100% 85.5% 84.6% None (many diffs) n/a
2 ccsbBroad304_02238 pLX_304 0% 85.5% 84.6% V5 (many diffs) n/a
3 TRCN0000465516 CTGACAAAAATGTACAGTCACAAC pLX_317 71.9% 85.5% 84.6% V5 (many diffs) n/a
Download CSV