Transcript: Mouse NM_026533.3

Mus musculus ribosomal protein S13 (Rps13), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rps13 (68052)
Length:
585
CDS:
84..539

Additional Resources:

NCBI RefSeq record:
NM_026533.3
NBCI Gene record:
Rps13 (68052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098519 ACGACGTGAAGGAACAGATTT pLKO.1 175 CDS 100% 13.200 7.920 N Rps13 n/a
2 TRCN0000435453 GAAAGGATAAGGATGCTAAAT pLKO_005 400 CDS 100% 13.200 6.600 Y RPS13 n/a
3 TRCN0000098518 TGAGAGGAACAGAAAGGATAA pLKO.1 389 CDS 100% 10.800 5.400 Y Rps13 n/a
4 TRCN0000098515 GATGCTAAATTCCGCCTGATT pLKO.1 411 CDS 100% 4.950 2.475 Y Rps13 n/a
5 TRCN0000098516 ACAGAAAGGATAAGGATGCTA pLKO.1 397 CDS 100% 3.000 1.500 Y Rps13 n/a
6 TRCN0000098517 CCCAGATAGGTGTAATCCTGA pLKO.1 226 CDS 100% 2.640 1.320 Y Rps13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01452 pDONR223 100% 86.9% 100% None (many diffs) n/a
2 ccsbBroad304_01452 pLX_304 0% 86.9% 100% V5 (many diffs) n/a
3 TRCN0000478232 AGTCCCCACTGTAGGACGATGTAC pLX_317 64.2% 86.9% 100% V5 (many diffs) n/a
Download CSV