Transcript: Mouse NM_026683.1

Mus musculus acyl-Coenzyme A binding domain containing 6 (Acbd6), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Acbd6 (72482)
Length:
992
CDS:
519..932

Additional Resources:

NCBI RefSeq record:
NM_026683.1
NBCI Gene record:
Acbd6 (72482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201261 GCCAAGCAATGCAGGAATATA pLKO.1 841 CDS 100% 15.000 12.000 N Acbd6 n/a
2 TRCN0000297649 GCCAAGCAATGCAGGAATATA pLKO_005 841 CDS 100% 15.000 12.000 N Acbd6 n/a
3 TRCN0000201950 CTAGCCAAGCAATGCAGGAAT pLKO.1 838 CDS 100% 4.950 3.465 N Acbd6 n/a
4 TRCN0000202124 CAGGATGGAATCCTCAGGTAT pLKO.1 886 CDS 100% 4.950 6.930 N Acbd6 n/a
5 TRCN0000297648 CAGGATGGAATCCTCAGGTAT pLKO_005 886 CDS 100% 4.950 6.930 N Acbd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04376 pDONR223 100% 40.7% 38.9% None (many diffs) n/a
2 ccsbBroad304_04376 pLX_304 0% 40.7% 38.9% V5 (many diffs) n/a
3 TRCN0000477142 TTTTTGTCGTAGCTTACGCACTCA pLX_317 45.4% 40.7% 38.9% V5 (many diffs) n/a
Download CSV