Transcript: Mouse NM_026690.1

Mus musculus aspartate dehydrogenase domain containing (Aspdh), mRNA.

Source:
NCBI, updated 2019-02-16
Taxon:
Mus musculus (mouse)
Gene:
Aspdh (68352)
Length:
966
CDS:
38..901

Additional Resources:

NCBI RefSeq record:
NM_026690.1
NBCI Gene record:
Aspdh (68352)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266772 CTAGGCTTCGACCGTGTCATT pLKO_005 659 CDS 100% 4.950 6.930 N Aspdh n/a
2 TRCN0000266774 CACCCTGACCTTGTGGTAGAA pLKO_005 248 CDS 100% 4.950 3.465 N Aspdh n/a
3 TRCN0000283313 CAGAACTGGGCCTAGAACTTG pLKO_005 138 CDS 100% 4.950 3.465 N Aspdh n/a
4 TRCN0000283311 AGTGAAGACATCAGCAGACTG pLKO_005 440 CDS 100% 4.050 2.835 N Aspdh n/a
5 TRCN0000266773 TGACCTTAGCCTCACCGACAT pLKO_005 694 CDS 100% 4.050 2.835 N Aspdh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10184 pDONR223 100% 52.6% 53.8% None (many diffs) n/a
2 ccsbBroad304_10184 pLX_304 0% 52.6% 53.8% V5 (many diffs) n/a
3 TRCN0000472804 GTGATACCTCCTTCTCCCGACCCA pLX_317 76.5% 52.6% 53.8% V5 (many diffs) n/a
Download CSV