Transcript: Mouse NM_026758.3

Mus musculus M phase phosphoprotein 6 (Mphosph6), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mphosph6 (68533)
Length:
1054
CDS:
28..513

Additional Resources:

NCBI RefSeq record:
NM_026758.3
NBCI Gene record:
Mphosph6 (68533)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088179 CGAGCCAATTACGAAGAAGAT pLKO.1 433 CDS 100% 4.950 6.930 N Mphosph6 n/a
2 TRCN0000326834 CGAGCCAATTACGAAGAAGAT pLKO_005 433 CDS 100% 4.950 6.930 N Mphosph6 n/a
3 TRCN0000088181 CGATGTGTCTGATGAGGAAAT pLKO.1 351 CDS 100% 10.800 7.560 N Mphosph6 n/a
4 TRCN0000326774 CGATGTGTCTGATGAGGAAAT pLKO_005 351 CDS 100% 10.800 7.560 N Mphosph6 n/a
5 TRCN0000088178 GCCTTTGTTTAACTGCCCTTA pLKO.1 826 3UTR 100% 4.050 2.835 N Mphosph6 n/a
6 TRCN0000326776 GCCTTTGTTTAACTGCCCTTA pLKO_005 826 3UTR 100% 4.050 2.835 N Mphosph6 n/a
7 TRCN0000088182 GATATGAGACTTTGGTGGGAA pLKO.1 380 CDS 100% 2.640 1.848 N Mphosph6 n/a
8 TRCN0000326833 GATATGAGACTTTGGTGGGAA pLKO_005 380 CDS 100% 2.640 1.848 N Mphosph6 n/a
9 TRCN0000088180 GCTTCAGATGAATTCTAAGAA pLKO.1 291 CDS 100% 0.000 0.000 N Mphosph6 n/a
10 TRCN0000326771 GCTTCAGATGAATTCTAAGAA pLKO_005 291 CDS 100% 0.000 0.000 N Mphosph6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026758.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07566 pDONR223 100% 82.8% 86.9% None (many diffs) n/a
2 ccsbBroad304_07566 pLX_304 0% 82.8% 86.9% V5 (many diffs) n/a
3 ccsbBroadEn_07567 pDONR223 100% 82.8% 87.5% None (many diffs) n/a
4 ccsbBroad304_07567 pLX_304 0% 82.8% 87.5% V5 (many diffs) n/a
5 TRCN0000474447 TGCATATCCCCCGCTCTTACTGTT pLX_317 75.8% 82.8% 87.5% V5 (many diffs) n/a
6 ccsbBroadEn_15696 pDONR223 0% 28.3% 31.6% None (many diffs) n/a
Download CSV