Transcript: Mouse NM_026759.3

Mus musculus mitochondrial ribosomal protein L13 (Mrpl13), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mrpl13 (68537)
Length:
786
CDS:
29..565

Additional Resources:

NCBI RefSeq record:
NM_026759.3
NBCI Gene record:
Mrpl13 (68537)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104442 CCTGGCAAACTTGCGGTTATA pLKO.1 110 CDS 100% 13.200 18.480 N Mrpl13 n/a
2 TRCN0000316486 CCTGGCAAACTTGCGGTTATA pLKO_005 110 CDS 100% 13.200 18.480 N Mrpl13 n/a
3 TRCN0000104444 ACGAGGATATTCCGGAAGATA pLKO.1 417 CDS 100% 5.625 4.500 N Mrpl13 n/a
4 TRCN0000316485 ACGAGGATATTCCGGAAGATA pLKO_005 417 CDS 100% 5.625 4.500 N Mrpl13 n/a
5 TRCN0000104441 CCGGAAGATATTCTTAAGAAT pLKO.1 428 CDS 100% 5.625 4.500 N Mrpl13 n/a
6 TRCN0000316484 CCGGAAGATATTCTTAAGAAT pLKO_005 428 CDS 100% 5.625 4.500 N Mrpl13 n/a
7 TRCN0000104443 CGATTGTGAAATTGGCTATTT pLKO.1 333 CDS 100% 13.200 9.240 N Mrpl13 n/a
8 TRCN0000316487 CGATTGTGAAATTGGCTATTT pLKO_005 333 CDS 100% 13.200 9.240 N Mrpl13 n/a
9 TRCN0000104440 GACTGAATGTTTCCTGAAGTA pLKO.1 598 3UTR 100% 4.950 3.465 N Mrpl13 n/a
10 TRCN0000316417 GACTGAATGTTTCCTGAAGTA pLKO_005 598 3UTR 100% 4.950 3.465 N Mrpl13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03063 pDONR223 100% 87.2% 89.3% None (many diffs) n/a
2 ccsbBroad304_03063 pLX_304 0% 87.2% 89.3% V5 (many diffs) n/a
3 TRCN0000471306 CATGCCTACTCTTAACTAACACAA pLX_317 95.8% 87.2% 89.3% V5 (many diffs) n/a
Download CSV