Transcript: Mouse NM_026763.2

Mus musculus collagen, type VI, alpha 4 (Col6a4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Col6a4 (68553)
Length:
7439
CDS:
49..6978

Additional Resources:

NCBI RefSeq record:
NM_026763.2
NBCI Gene record:
Col6a4 (68553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090981 GCCAAATGTTACGGAGACGAT pLKO.1 4267 CDS 100% 2.640 3.696 N Col6a4 n/a
2 TRCN0000089787 GCTTTCAGTTTATCACCGCAA pLKO.1 303 CDS 100% 2.160 3.024 N Col6a4 n/a
3 TRCN0000090980 CCAACGAATTTCACCTGTTTA pLKO.1 5849 CDS 100% 13.200 9.240 N Col6a4 n/a
4 TRCN0000090982 GCCTTCCTGAACCTTCTAAAT pLKO.1 6592 CDS 100% 13.200 9.240 N Col6a4 n/a
5 TRCN0000090978 CGGAGAAGGATTAAATTCTAT pLKO.1 7258 3UTR 100% 5.625 3.938 N Col6a4 n/a
6 TRCN0000090979 GCTGACATCATCTTCTTGATT pLKO.1 3133 CDS 100% 5.625 3.938 N Col6a4 n/a
7 TRCN0000089786 GCTGTAGAAGAATGTCTAGTT pLKO.1 1915 CDS 100% 4.950 3.465 N Col6a4 n/a
8 TRCN0000089784 GCTTTAGACTTCCTGAGGAAA pLKO.1 2200 CDS 100% 4.950 3.465 N Col6a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.