Transcript: Mouse NM_026767.4

Mus musculus dolichyl-phosphate mannosyltransferase polypeptide 3 (Dpm3), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Dpm3 (68563)
Length:
506
CDS:
152..430

Additional Resources:

NCBI RefSeq record:
NM_026767.4
NBCI Gene record:
Dpm3 (68563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026767.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252256 GGCTATCGCGTAGCTACATTT pLKO_005 323 CDS 100% 13.200 18.480 N Dpm3 n/a
2 TRCN0000258197 ACTGGGCTTGGAGTTGCCTTT pLKO_005 226 CDS 100% 4.050 2.835 N Dpm3 n/a
3 TRCN0000252257 TTGGTCTCCGCTGGCTGCTAT pLKO_005 287 CDS 100% 1.650 1.155 N Dpm3 n/a
4 TRCN0000252258 CCCTGACCATGGGAGCACTGG pLKO_005 210 CDS 100% 0.000 0.000 N Dpm3 n/a
5 TRCN0000252259 ACTGCCTGCCTACCTGTTGGT pLKO_005 271 CDS 100% 0.880 0.528 N Dpm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026767.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03410 pDONR223 100% 64.2% 68% None (many diffs) n/a
2 ccsbBroad304_03410 pLX_304 0% 64.2% 68% V5 (many diffs) n/a
3 TRCN0000469960 CTGTTTCAGTGGCGGCAATATCAG pLX_317 82.5% 64.2% 68% V5 (many diffs) n/a
Download CSV