Transcript: Mouse NM_026795.3

Mus musculus TM2 domain containing 3 (Tm2d3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tm2d3 (68634)
Length:
910
CDS:
63..755

Additional Resources:

NCBI RefSeq record:
NM_026795.3
NBCI Gene record:
Tm2d3 (68634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026795.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121457 CCTGGGAATATGGACCCTAAT pLKO.1 674 CDS 100% 10.800 7.560 N Tm2d3 n/a
2 TRCN0000121458 CCAGAGGAACTTCGTCATCAA pLKO.1 356 CDS 100% 4.950 3.465 N Tm2d3 n/a
3 TRCN0000121461 GATGTCTTGCTGATTGGAGTT pLKO.1 696 CDS 100% 4.050 2.835 N Tm2d3 n/a
4 TRCN0000121460 TGCTACATTCTGTCGGGAGAT pLKO.1 132 CDS 100% 4.050 2.835 N Tm2d3 n/a
5 TRCN0000121459 CTGTATAGAATGTGCGACCAA pLKO.1 251 CDS 100% 2.640 1.848 N Tm2d3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026795.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09014 pDONR223 100% 80.5% 83.9% None (many diffs) n/a
2 ccsbBroad304_09014 pLX_304 0% 80.5% 83.9% V5 (many diffs) n/a
3 TRCN0000471209 TAGAACCACACTTCCGCCCACACC pLX_317 67% 80.5% 83.9% V5 (many diffs) n/a
Download CSV