Transcript: Mouse NM_026807.2

Mus musculus keratin associated protein 4-2 (Krtap4-2), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Krtap4-2 (68673)
Length:
971
CDS:
61..564

Additional Resources:

NCBI RefSeq record:
NM_026807.2
NBCI Gene record:
Krtap4-2 (68673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098350 CCTCCAAATAGCTTAACAGAT pLKO.1 748 3UTR 100% 4.950 3.465 N Krtap4-2 n/a
2 TRCN0000098352 CCAGCTGCTGTGGTTCTAGTT pLKO.1 332 CDS 100% 4.950 2.475 Y Krtap4-2 n/a
3 TRCN0000098353 CTGCTGCCAAACCACTTGCTA pLKO.1 480 CDS 100% 3.000 1.500 Y Krtap4-2 n/a
4 TRCN0000098351 GCTGCCAAACCACCTGCTGTA pLKO.1 128 CDS 100% 1.350 0.675 Y Krtap4-2 n/a
5 TRCN0000098354 GCTGTCAACCCTCCTGTGGTA pLKO.1 308 CDS 100% 0.880 0.440 Y Krtap4-2 n/a
6 TRCN0000116660 CTGCTGTGTGTCCAGCTGCTT pLKO.1 171 CDS 100% 0.880 0.440 Y KRTAP4-2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04297 pDONR223 100% 71% 65.6% None (many diffs) n/a
2 ccsbBroad304_04297 pLX_304 0% 71% 65.6% V5 (many diffs) n/a
3 TRCN0000468341 CATGCCGTACGCCCACATCGATGC pLX_317 62.9% 71% 65.6% V5 (many diffs) n/a
Download CSV